Id Trinity | FTRINITY_DN19739_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_151324 |
Sequence | AAAGGAAAGGAGATTGTTGAAGTCAAGCCGCAATGGGTTACTAAAGGGTCAGTCACACAGGAAGTTCTGTCTGCTCTAACCAGGGCTGGGAAATCGCCAG ATTTTGTATTGTGCATCGGGGATGATCGATCCGATGAGGATATGTTTGAGAGCATACTTACCAAAGCATATGGTGCAACCTCCTCTACCTCCCCAGAAAT GTTTGCTTGTACCGTCGGGCAAAAACCTAGCAAGGCAAGGTACTACGTAGATGATACGATGGAGGCGAACATGATACTTCAAGGTCTTTCTGCTATTTCA GCCATTATGATAAGATCTGCCGCGGCTTCGGTTTAAAAACCGTAATTCTCTTTGGAGAATATAGTTTGAAATGCCTGTCTAGGCACCAGCATAGCC BLAST |
Tissue | flowers |
Gene name | LI_gene_2196; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_151324
Blastp | Probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 10 from Arabidopsis with 55.45% of identity |
---|---|
Blastx | Probable alpha,alpha-trehalose-phosphate synthase [UDP-forming] 10 from Arabidopsis with 57.29% of identity |
Eggnog | synthase(COG0380) |
Kegg | Link to kegg annotations (AT1G60140) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019430358.1) |
Pfam | Trehalose-phosphatase (PF02358.15) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |