Id Trinity | FTRINITY_DN19991_c0_g1_i2 |
---|---|
Name Transcript | Ll_transcript_40335 |
Sequence | CTTAACTAATAAAATGGCACCAGCTTTGAGGAGGGTGTACGATCAGATGCCAGAGCCCCGTTGGGTTATTTCTATGGGTAGCTGTGCTAATGGTGGTGGA TATTACCACTACTCATATTCAGTTGTTCGAGGATGTGATCGGATTATCCCAGTGGACATCTATGTACCTGGCTGCCCACCTACAGCAGAAGCCTTGATGT ATGGTGTGCTCCAGTTACAGCGCAAGGTCAAGCGCATGACAAC BLAST |
Tissue | flowers |
Gene name | LI_gene_2298; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_40335
Blastp | - |
---|---|
Blastx | NADH-quinone oxidoreductase subunit B 1 from Rhodobacter with 91.03% of identity |
Eggnog | NDH-1 shuttles electrons from NADH, via FMN and iron- sulfur (Fe-S) centers, to quinones in the respiratory chain. The immediate electron acceptor for the enzyme in this species is believed to be ubiquinone. Couples the redox reaction to proton translocation (for every two electrons transferred, four hydrogen ions are translocated across the cytoplasmic membrane), and thus conserves the redox energy in a proton gradient (By similarity)(COG0377) |
Kegg | Link to kegg annotations (RSP_2513) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_014502309.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |