| Id Trinity | FTRINITY_DN20188_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_66676 |
| Sequence | GAAACTGTTAAATTTAAGGGTTCCCGTCGTGTCTTTGGTACAAAAGTGTGGATTAAAACATTATCAAGCACCTCCCAAATATGACCATGTTGAATTTCCG GAAAAACCAAAACTTAAATACATTGATAAGGTCCCACAGCTACCTGCTGCAATTAAACCACCAAAAATGCAAAAAAACTTAAAGCTAATGAGAGGCCCCG AGCCAGTACACAATTTTTTGTTACATAAACAATATGGCATCATGGCTTTATGCGGAGGTAGAATAAAGTGGGGTCATTTCGAAATGATGAGGTTAACAGT TGGTAGAAAAATGGACTTGAACAGAATGTTTGCTGTTTGGAGGATAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_2383; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_66676
| Blastp | 39S ribosomal protein L16, mitochondrial from Pongo with 41.74% of identity |
|---|---|
| Blastx | 39S ribosomal protein L16, mitochondrial from Pongo with 41.74% of identity |
| Eggnog | Binds 23S rRNA and is also seen to make contacts with the A and possibly P site tRNAs (By similarity)(COG0197) |
| Kegg | Link to kegg annotations (100173293) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003615299.1) |
| Pfam | Ribosomal protein L16p/L10e (PF00252.17) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |