Id Trinity | FTRINITY_DN20236_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_140219 |
Sequence | ATCAAATCCTGAAAGTTTGCTATTCTACCAAATTTTACAATTTGCTTGTACATTTGTGCTAATTGCAGCATTTTTTTTATAAGTATATAATTTGATTATC GTATGTCCATCCAGAATCTTAACACATTTGACCCATTTGCTGATGCAAGTAAGGGTGCAGATGATGATGTTCAAGACGGTCTTGTTCATATAAGAATCCA GCAACGGAATGGTCGTAAGACTTTAACTACAGTACAAGGACTTTCCTCTGAATATGACTTGAAAAAAATAGTAAGAGCATGTAAAAAGGAATTTGCCTGT AATGGAACTGTGATAGAGCACCCTGAATACGGAGAGGTTCTGCAGTTGCAAGGAGATCAACGAGAAAACATTTGTCAGTGGCTTACAAAAGCTGGACTAG CAAAACCAGACCAACTTAAAGTTCATGGATTTTAAAAATAGATCACAATATAATTGCAGTTTTTTATAAAGATAATACCTGTTTAATAGCAAATACTTAA AAATGATCAGTTAA BLAST |
Tissue | flowers |
Gene name | LI_gene_2399; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_140219
Blastp | Eukaryotic translation initiation factor eIF1 from Anopheles with 95.45% of identity |
---|---|
Blastx | Eukaryotic translation initiation factor eIF1 from Anopheles with 95.45% of identity |
Eggnog | translation initiation factor(COG0023) |
Kegg | Link to kegg annotations (AgaP_AGAP006459) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019458867.1) |
Pfam | Translation initiation factor SUI1 (PF01253.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |