Id Trinity | FTRINITY_DN21820_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_272097 |
Sequence | AATAAATCCATTTTCCTTGTTTTCTGTTTTCTCCTCTTATAATATAAAATTTTCTATAATTTTCTTTATCTTTCTCTTTACTTTTATGTGTCTATGTCTA TGGCTGGTTTGGATTTAGGAACTGCTTCACGCTATGCTCAAAACCTTCACAGAGAAAGCTTGCACCATCACCAACATCACCACCATGATTCCGAAAAACA AGACCATCACAATCATCACCATCGTGGTGCAGATGCAGATGCGTTTTCCACTGAAGAAGATGATAAGAGCCAAGGTTTAGAGCTGGGGTCGGCTTCAGGC GGCGGTCCTGATGATGTTATCGGCCGCCGCCCACGAGGCCGACCTCCGGGATCCAAGAACAAGGCAAAGCCTCCGGTGATAATCACTAGAGAAAGCGCCA ATACACTAAGGGCCC BLAST |
Tissue | flowers |
Gene name | LI_gene_3104; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_272097
Blastp | AT-hook motif nuclear-localized protein 21 from Arabidopsis with 39.47% of identity |
---|---|
Blastx | AT-hook motif nuclear-localized protein 23 from Arabidopsis with 46.61% of identity |
Eggnog | DNA-binding protein ESCAROLA-like(ENOG410YG7Z) |
Kegg | Link to kegg annotations (AT2G35270) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019420536.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |