Id Trinity | FTRINITY_DN21901_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_66852 |
Sequence | CAGAAGATAAGTTGAGTAGCTTGCATGACTATATTTTATTGCACATCATGGGTTTTTTGAGAACAAAACATGCCGTCCGAACTTGTGTCTTGTCTAAGAG ATGGGAGCACCTTTGGAAAAGCCTTACAAGTTTCAAGTTCGACTCCTCAAACTTCCAAAATGTTGTACAATTCAGAGAGTTTTTATCTTCGTTTTTGTCT CATCGAGATAGGTCCATCTCCTTGGAAAATATTTCTTTTAGACACCCTGGTTACATTGGTGATGAAATCCTGAATAGCTTTATTGAACATGTTGTATCAC ATGGTATCCAACAATTGACACTTGATACCAAGTTTGAAAAGCTTCCCCCTTGCATCTTTTCGTGTGAGACTTTGACATTTCTTAAGATTTCCAGTCCCTC CACTCCGTTCAAGâBLAST |
Tissue | flowers |
Gene name | LI_gene_3154; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_66852
Blastp | F-box/FBD/LRR-repeat protein At5g53840 from Arabidopsis with 33.33% of identity |
---|---|
Blastx | F-box/FBD/LRR-repeat protein At5g53840 from Arabidopsis with 33.33% of identity |
Eggnog | F-box FBD LRR-repeat protein(ENOG411188E) |
Kegg | Link to kegg annotations (AT5G53840) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019462865.1) |
Pfam | F-box domain (PF00646.32) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |