Id Trinity | FTRINITY_DN21917_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_66853 |
Sequence | GTAATAATGAAATTACAAATAGTATTGTTAATTGTTGTGTTTGTAGCAGCATACGCCGCTCCACAGAATAAATACACCTCCAAATATGACAACATCGATC TGGATTCAATTTTTAAAAGTGACAGGCTTCTATCAAACTACATAAACTGTTTAATGGACAGAGGAAGATGCACACCAGATGCTATGGAACTTAAAATTGT CCTTCCTGATGCACTACAAAACGATTGTGCCAAATGCAGCGAAGAACAACAGAAATCTGGCAAAAAGGTGGTTAATTTTATGATTAAAAACAAACCCAAT GAGTGGAAGGAACTTGAACAAAAGTATGATCCTGAAGGAATTTACAAAAAAAAATACGATGAAGAAATAAAACACTAATTTAATATTTTTATACGATAAA TGTATATTCTTAATTATAGTTAATAGGTTTG BLAST |
Tissue | flowers |
Gene name | LI_gene_3163; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_66853
Blastp | Ejaculatory bulb-specific protein 3 from Sophophora with 58.16% of identity |
---|---|
Blastx | Ejaculatory bulb-specific protein 3 from Sophophora with 58.16% of identity |
Eggnog | protein serine threonine kinase(ENOG4111U5H) |
Kegg | Link to kegg annotations (Dmel_CG11390) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_015970847.1) |
Pfam | Insect pheromone-binding family, A10/OS-D (PF03392.12) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |