Ll_transcript_66870

• Id Trinity: FTRINITY_DN21937_c0_g1_i1
• Name Transcript: Ll_transcript_66870
• Sequence: TACACCTTCAGCGGCTCCACGTACTCCTCGAACCCTAGCGTCGTCATCGCCCACAGCAAATCGTCGCCGTTTATCGTCTTACGCTTCTCCCTCTGGCACT TATCGGAGGCTTCGCCGGTGATGAAGCTTATGAACTCCGACACGCACTCCTGAACGGTTTCCTTTGCGTCCTTGGATATCTTAGCGTTCGCTGGTAAAGC CTTCTTCATGATCCTGCTCACGTTCGCAATCGGAAGGAAACGGTCTTGTTCTCGCAACGATAACTCTCCCTGCGCATTCTCCACGTTCTGACCTCCTGAC TCGTTGTCCGAGTCCGCCATCACTCGATAGAGATTCCACACTATCTCGACTCCACTACTTGAAATCCACGTAATTCCAATTCAACATAACCACTGTTCAG TTGTAATTGGGAATACGGAATTGAAATAGCGTTGACTAGAGGGAGGAATTA
• Tissue: flowers
• Gene name: LI_gene_3172;
• Additional information: -

Expression of Ll_transcript_66870

FPKM

• FPAB: 0.2
• FPNAB: 0.1
• LF1: 0.4
• LF2: 0.1
• LF3: 0
• LF4: 0.1
• UF1: 0
• UF2: 0.3
• UF3: 0.1
• UF4: 0.5

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_66870

• Blastp: -
• Blastx: Nuclear transcription factor Y subunit B-3 from Arabidopsis with 88.68% of identity
• Eggnog: Core component of nucleosome. Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template. Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability. DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling(COG2036)
• Kegg: Link to kegg annotations (AT4G14540)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019456034.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;