Id Trinity | FTRINITY_DN22063_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_82972 |
Sequence | AAACCCACACAATCTTCTGTTAGAGAACTTAGAGGTTTGGGTTTGTCTCCTGACATTATTGTTTGTCGTTCAGAAAAACCAATTGGTCAAAGTGTAAAAG ATAAAATTTCGAATTTCTGTCATGTGGCTCCAGAACAAATTATAAGCATTCCCGATTTATCTTCTGTTTATGAAGTACCAGTATTTATGGAAAACCATGG AATGGCATCTTATCTCAATGAACGTCTAAAACTTGGCCTGACATTTGGTTCAAGCAAAAGATACATGAAACCATGGATTGACCTAAGTGAGAGGATGAAC CATCTTAAGGGTGAAGTTGTTATTGCAATAGTTGGTAAATACACACGTCTTGAAGATTCCTATAC BLAST |
Tissue | flowers |
Gene name | LI_gene_3220; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_82972
Blastp | CTP synthase from Sophophora with 60.33% of identity |
---|---|
Blastx | CTP synthase from Sophophora with 60.33% of identity |
Eggnog | Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen (By similarity)(COG0504) |
Kegg | Link to kegg annotations (Dmel_CG45070) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_016175708.1) |
Pfam | CTP synthase N-terminus (PF06418.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |