| Id Trinity | FTRINITY_DN22063_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_82972 |
| Sequence | AAACCCACACAATCTTCTGTTAGAGAACTTAGAGGTTTGGGTTTGTCTCCTGACATTATTGTTTGTCGTTCAGAAAAACCAATTGGTCAAAGTGTAAAAG ATAAAATTTCGAATTTCTGTCATGTGGCTCCAGAACAAATTATAAGCATTCCCGATTTATCTTCTGTTTATGAAGTACCAGTATTTATGGAAAACCATGG AATGGCATCTTATCTCAATGAACGTCTAAAACTTGGCCTGACATTTGGTTCAAGCAAAAGATACATGAAACCATGGATTGACCTAAGTGAGAGGATGAAC CATCTTAAGGGTGAAGTTGTTATTGCAATAGTTGGTAAATACACACGTCTTGAAGATTCCTATAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_3220; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_82972
| Blastp | CTP synthase from Sophophora with 60.33% of identity |
|---|---|
| Blastx | CTP synthase from Sophophora with 60.33% of identity |
| Eggnog | Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen (By similarity)(COG0504) |
| Kegg | Link to kegg annotations (Dmel_CG45070) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_016175708.1) |
| Pfam | CTP synthase N-terminus (PF06418.13) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |