Id Trinity | FTRINITY_DN22787_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_270265 |
Sequence | GTTCAATTAGGTAATTTATCAAAGAAAGTTCAGTCTGCAGAGGAGATTGCACAAGTTGCCACAATATCTGCTAATGGTGATACTAGTATTGGACAACTTA TTTCATCAGCTATGGAAAAAGTAGGAAAAGATGGTGTGATAACAGTCAAAGATGGAAAAACCTTAGAAGATGAATTGGAAGTTATTGAAGGTTTGAAATT TGATAGAGGGTACATTTCCCCATATTTCATCAACTCTGCTAAAGGTGCCAAAGTAGAATTCCAAGATGCTTTGGTGTTGTTCAGCGAGAAAAAAATTTCA TCTGCTCAATCATTAATTCCTGCTTTAGAATTAGCTAATGCACAACGTAAACCACTTGTTATAGTTGCTGAAGACCTTGATGGTGAAGTTATTGGAATGC TAGTTTTAAATAGATTGAAAATTGGTCTAAATGTTGCTGCCGTCAAAGCGCCTGGATTTGGAGATAATCGCAAATCTACATTGACTGATATGGCAATTGC AACTGGAGG BLAST |
Tissue | flowers |
Gene name | LI_gene_3522; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_270265
Blastp | 60 kDa heat shock protein, mitochondrial from Sophophora with 82.04% of identity |
---|---|
Blastx | 60 kDa heat shock protein, mitochondrial from Sophophora with 82.04% of identity |
Eggnog | Prevents misfolding and promotes the refolding and proper assembly of unfolded polypeptides generated under stress conditions (By similarity)(COG0459) |
Kegg | Link to kegg annotations (Dmel_CG12101) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019435425.1) |
Pfam | TCP-1/cpn60 chaperonin family (PF00118.23) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |