| Id Trinity | FTRINITY_DN22787_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_270265 |
| Sequence | GTTCAATTAGGTAATTTATCAAAGAAAGTTCAGTCTGCAGAGGAGATTGCACAAGTTGCCACAATATCTGCTAATGGTGATACTAGTATTGGACAACTTA TTTCATCAGCTATGGAAAAAGTAGGAAAAGATGGTGTGATAACAGTCAAAGATGGAAAAACCTTAGAAGATGAATTGGAAGTTATTGAAGGTTTGAAATT TGATAGAGGGTACATTTCCCCATATTTCATCAACTCTGCTAAAGGTGCCAAAGTAGAATTCCAAGATGCTTTGGTGTTGTTCAGCGAGAAAAAAATTTCA TCTGCTCAATCATTAATTCCTGCTTTAGAATTAGCTAATGCACAACGTAAACCACTTGTTATAGTTGCTGAAGACCTTGATGGTGAAGTTATTGGAATGC TAGTTTTAAATAGATTGAAAATTGGTCTAAATGTTGCTGCCGTCAAAGCGCCTGGATTTGGAGATAATCGCAAATCTACATTGACTGATATGGCAATTGC AACTGGAGG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_3522; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_270265
| Blastp | 60 kDa heat shock protein, mitochondrial from Sophophora with 82.04% of identity |
|---|---|
| Blastx | 60 kDa heat shock protein, mitochondrial from Sophophora with 82.04% of identity |
| Eggnog | Prevents misfolding and promotes the refolding and proper assembly of unfolded polypeptides generated under stress conditions (By similarity)(COG0459) |
| Kegg | Link to kegg annotations (Dmel_CG12101) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019435425.1) |
| Pfam | TCP-1/cpn60 chaperonin family (PF00118.23) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |