| Id Trinity | FTRINITY_DN23148_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_69810 |
| Sequence | TTAAAGTACAAAAAATGGAAGGTAAATCAACAGATGTGCATTTAAGGGCTATGCTGAATAGCCCTGCGAGATTCACGCCTGCAGTGCCCACCCCTGACTG GAATTTAACCCCGACTCAACCACAAACAGCACAACCATCTACGACTAATCCTGGCCCCACAAATCCTTCAATTGTCGTTGCGACGCCAGGTTCAGCGCTT GGAGAACCTCACACAAACATAACCTTGCAAAATTGTGTGGCTACAGTCGATTTACACACTACATTGGATTTACAGCTGGTAAATGCGAGGACAAGAAATA CGGAATACAACCCATCAAGATTTCACGGAGTGATAATGAGAATAAGAGâBLAST |
| Tissue | flowers |
| Gene name | LI_gene_3654; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_69810
| Blastp | TBP-related factor from Sophophora with 54.72% of identity |
|---|---|
| Blastx | TBP-related factor from Sophophora with 54.72% of identity |
| Eggnog | General factor that plays a role in the activation of archaeal genes transcribed by RNA polymerase. Binds specifically to the TATA box promoter element which lies close to the position of transcription initiation (By similarity)(COG2101) |
| Kegg | Link to kegg annotations (Dmel_CG7562) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_013455176.1) |
| Pfam | Transcription factor TFIID (or TATA-binding protein, TBP) (PF00352.20) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |