Ll_transcript_265037

• Id Trinity: FTRINITY_DN23271_c0_g1_i2
• Name Transcript: Ll_transcript_265037
• Sequence: GGATTTCTTTATACAATCGACTATTCCTACACAATCGGCTTCAGGGTCGCAGACTGCAATGTCATCATCATCCTCTGTGTATGAATGAGGTGACCGGAGA TTCCCATGGGTTTGGCAGGCCTTCATTGTCTTACAATGTTCAGCTTCATCATCTCTGATATTGACAAATACATCGTACAGGTTCTCTATCTTAGGCCTTC TAGTATTTGGAATCCTGGAAGTTTGAAATTCATCAAATAAATACAAGTCACCTCCAGTATAATAATTCACAGCAACCTCAGGAGCAGGCATCTTTTTC
• Tissue: flowers
• Gene name: LI_gene_3698;
• Additional information: details;

Expression of Ll_transcript_265037

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 1.5
• LF2: 0
• LF3: 0.4
• LF4: 0
• UF1: 1.7
• UF2: 0.8
• UF3: 0.9
• UF4: 1.4

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_265037

• Blastp: Ubiquinol oxidase 4, chloroplastic/chromoplastic from Arabidopsis with 76.7% of identity
• Blastx: Ubiquinol oxidase 4, chloroplastic/chromoplastic from Arabidopsis with 76.7% of identity
• Eggnog: Ubiquinol oxidase(ENOG410YEK7)
• Kegg: Link to kegg annotations (AT4G22260)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019439851.1)
• Pfam: Alternative oxidase (PF01786.16)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;