Id Trinity | FTRINITY_DN23769_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_103990 |
Sequence | ATTTTTTGAACCATTGGAACCTGTTGATATACGTATTCTTTTCAATAACAATAATCGACCATCTGGAGAAGCAAATGTTGAATTTGGTAACAAAGAAGAT GCAATGCGAGCTATGTCAAAAGATAAAACATATATGCAGCATAGATACATTGAACTGTTTATGGATGGACCGGTAGGAGGTGGACCAGGTTCTGGCGGTA ATAACTTTAGTATGGATGATATGGGACCACCAAATTCAGGCAATGGCGGGAGCTTTGGAGGATTTGGAAACAATTCATTTGGTGGTGGAGGTAGCAGCAG TGGTGGTGGCGGTGGAAATTCTTTTGGGAACAACACATTTTCTCGGCGTAATGATAACTCTGG BLAST |
Tissue | flowers |
Gene name | LI_gene_3845; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_103990
Blastp | Heterogeneous nuclear ribonucleoprotein H from Mus with 43.43% of identity |
---|---|
Blastx | Heterogeneous nuclear ribonucleoprotein H from Homo with 56.36% of identity |
Eggnog | heterogeneous nuclear ribonucleoprotein(ENOG410Z6M0) |
Kegg | Link to kegg annotations (59013) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_004500202.1) |
Pfam | RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (PF00076.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |