Id Trinity | FTRINITY_DN23808_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_97775 |
Sequence | AAGCCTTCCAAGTTCATCAGGAATGGAACCAGTGAGAGAGTTTGAGGAGAGGTCAAGGAGTTGAAGATGTGATAGTTGGCCAAAAGAGGGTGGAATGGAG CCAGAGACATTGGTGGAAGAGAGGTTGAGAAGTTGAAGCATTGATAGAGCTGAGAGCTGAGGAGGCAAATAGGAAATGTTAAGAAAAGTATCTGGAATAG AGAGAGAAATGACTCTACTTTGTGGAGAGCAAGTGATTCCATTCCATGAACATGGTGTTGAGCTTGAAGGGTTCCATGAAGAGAGAACAGAAGGTGATGA CTTAAGTGAAAGAAGGGCTTCTCCATCAGGTGAGAGACATGTGACTTCTACCCTTGTCATGGTGAGGCAGAACAACAATAAT BLAST |
Tissue | flowers |
Gene name | LI_gene_3858; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_97775
Blastp | Probable LRR receptor-like serine/threonine-protein kinase At1g34110 from Arabidopsis with 72.57% of identity |
---|---|
Blastx | Probable LRR receptor-like serine/threonine-protein kinase At1g34110 from Arabidopsis with 74.39% of identity |
Eggnog | leucine Rich Repeat(COG4886) |
Kegg | Link to kegg annotations (AT1G34110) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427537.1) |
Pfam | Leucine rich repeat N-terminal domain (PF08263.11) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |