| Id Trinity | FTRINITY_DN23968_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_266200 |
| Sequence | CATGGTTCATCAATTCACGACCATTCCAACTCTCACTGTTTCATGAAAATTCTGCAGGGATCCCTGGATGAAATCAAATTCGCTTGGCCTAAAGAAAAAG GGCAACAGCTCGAAGAAATCGAAAGGAAAAAAATTGAACTCAACCAAGTCGCCTATATGAATGATTCTCTTGGTCTTCACCGCGTTGAAAACTCATCTAA CGTAGACACTGCCATAAGCTTACATCTTTATTGTCCGCCTTACAATAAATGTAAGGTATTTAACCAAAATACTGGACAAACTAGTTCATCCACTGTGACA TTTTATTCCACATTTGGAAAAAGAATTAAGGAAAACAAGGAAATTATTGAACCAGAAGATAAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_3912; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_266200
| Blastp | Cysteine dioxygenase from Caenorhabditis with 54.74% of identity |
|---|---|
| Blastx | Cysteine dioxygenase type 1 from Pongo with 56.52% of identity |
| Eggnog | cysteine dioxygenase(ENOG410XQM4) |
| Kegg | Link to kegg annotations (CBG20456) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003555533.1) |
| Pfam | Cysteine dioxygenase type I (PF05995.11) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |