| Id Trinity | FTRINITY_DN24005_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_221967 |
| Sequence | CAGATGGCAGATTCAATTACCCATGGGGTATAACAACAGATGCCCTAGGTTTTATTTACGTTTGTGATAAAGAAAACCACAGAGTGCAGGTTTTCCAATC AGATGGCACCTTTGTGGGCAAATTTGGCTCCATGGGAAGCAAAGAAGGTCAACTAGAACACCCGCATTACATTGCAGTATCGAACACCAACAGAGTAGTT GTGTCAGATTCAAACAACCACCGCATTCAAATTTTCGATGTCAACGGTAAAGTTATAACGTCTTTCGGCACTGAAGGCTCTGAAGAAGGCCAGTTTAAGT TCCCCAGAGGTGTAGCCGTAGACGATCAAGGCTACATTTGCGTGGCAGATTCTGGAAACAACAGAATACAGATTTTCCAAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_3935; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_221967
| Blastp | RING finger protein nhl-1 from Caenorhabditis with 58.73% of identity |
|---|---|
| Blastx | RING finger protein nhl-1 from Caenorhabditis with 58.73% of identity |
| Eggnog | nhl repeat containing protein(ENOG410XSQC) |
| Kegg | - |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014495822.1) |
| Pfam | NHL repeat (PF01436.20) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |