Id Trinity | FTRINITY_DN24073_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_221950 |
Sequence | GTTCGACGACCCTAGAGATGCAGAAGATGCAGTTCATGCTAGAGATGGTTATGATTATGATGGCTACAGATTACGTGTAGAGTTTCCACGTGGAAATGGT CCACATAGAAGTGGCGGAGGTGGTGGCAGTAGTAGTGGTGGTGGAAGTTATAATAGAGGAGGTGCTAGTGGTGGAAGCGGAAGAAGCAGAGGTCCACCAG CGAGGCGTTCTCAGTATAGAGTACTTGTTACTGGATTACCAGCGTCAGGAAGTTGGCAAGATTTAAAAGATCATATGCGTGAAGCAGGAGATGTGTGTTA TGCAGATGTATACAAAGATGGAACTGGCGTAGTTGAGTTTTTACGTTATGACGATA BLAST |
Tissue | flowers |
Gene name | LI_gene_3960; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_221950
Blastp | Serine/arginine-rich splicing factor 1A from Danio with 69.49% of identity |
---|---|
Blastx | Serine/arginine-rich splicing factor 1A from Danio with 67.8% of identity |
Eggnog | Rna-binding protein(COG0724) |
Kegg | Link to kegg annotations (406288) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019453087.1) |
Pfam | RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (PF00076.21) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |