| Id Trinity | FTRINITY_DN24073_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_221950 |
| Sequence | GTTCGACGACCCTAGAGATGCAGAAGATGCAGTTCATGCTAGAGATGGTTATGATTATGATGGCTACAGATTACGTGTAGAGTTTCCACGTGGAAATGGT CCACATAGAAGTGGCGGAGGTGGTGGCAGTAGTAGTGGTGGTGGAAGTTATAATAGAGGAGGTGCTAGTGGTGGAAGCGGAAGAAGCAGAGGTCCACCAG CGAGGCGTTCTCAGTATAGAGTACTTGTTACTGGATTACCAGCGTCAGGAAGTTGGCAAGATTTAAAAGATCATATGCGTGAAGCAGGAGATGTGTGTTA TGCAGATGTATACAAAGATGGAACTGGCGTAGTTGAGTTTTTACGTTATGACGATA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_3960; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_221950
| Blastp | Serine/arginine-rich splicing factor 1A from Danio with 69.49% of identity |
|---|---|
| Blastx | Serine/arginine-rich splicing factor 1A from Danio with 67.8% of identity |
| Eggnog | Rna-binding protein(COG0724) |
| Kegg | Link to kegg annotations (406288) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019453087.1) |
| Pfam | RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (PF00076.21) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |