Id Trinity | FTRINITY_DN24301_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_78018 |
Sequence | GAAGGATGTTCTGCTCTCCGCCGATTCTGGATGCAAATATGATCAGGTTATTGAAATTGATCTGAGCACACTGGAACCTCATGTCAATGGTCCCTTCACT CCTGACCTTGCTCACCCCATCAGCAAACTGAAGGATAATGCTAAGAAGGCTGGCTGGCCTGAAGAAATCAAAGTTGGTCTTATTGGAAGCTGCACCAACT CAAGTTATGAAGACATGTCAAGATGTGCTACTATTGCAAAAGAAGCCTTAGCTCATGGTCGCAAATCAAAAATTCCATTTAATGTTACTCCTGGATCTGA ACAAATTAGGGCAACAATTGAAAGAGATGGAATTGCACAAACTCTGAGAGAATTTGGAGGAACTGTACTAGCTAATGCATGCGGTCCATGTATTGGTCAA TGGGACCGTAAAGATGTCAAAAAGGG BLAST |
Tissue | flowers |
Gene name | LI_gene_4053; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_78018
Blastp | Aconitate hydratase, mitochondrial from Aspergillus with 75.18% of identity |
---|---|
Blastx | Aconitate hydratase, mitochondrial from Aspergillus with 75.18% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (AN5525.2) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003537655.1) |
Pfam | Aconitase family (aconitate hydratase) (PF00330.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |