Id Trinity | FTRINITY_DN24515_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_197951 |
Sequence | CTGAAACATATAAAATTTGGAATGACATCATTAAAATACCTTCAGAACGTATTATTAGAATAGGTGATAAAAATAAAGAGAAATACAATTCTGAAAATTT TTGGCAAATGGGTGATACTGGTCCATGTGGTCCTTGTACTGAAATATTTTATGATTATTCAGATACAATGAAAATTGATCCAATAGAGTTTTTAGAAAAT AAAAACGGCCGTTTTGTTGAAATTTGGAATATTGTTTTTATAGAATTCAATCGTATCTCCAAGACAAAAATTATTTCTTTAAAAAATAAATCCATAGATA CAGGCATGGGATTAGAAAGAATATCTGCTGTTTTACAAAATGTGTATTCTAACTATCATATAGATGTATTTCAAAAACTAATAAAAAATATAGCCCAATT AAGCTCTATAAATAATTTAGACCATATTTCTTTTCAAGTAATAGCTGACCATATTAGATCCTGTTCATACATTATTGCAGATAATATTCTTCCATCAAAT GAACATAGAGGTTATATTTTAAGAAGAATTATCAGAAGAGCATTAAGACATG BLAST |
Tissue | flowers |
Gene name | LI_gene_4143; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_197951
Blastp | Alanine--tRNA ligase from Buchnera with 100% of identity |
---|---|
Blastx | Alanine--tRNA ligase from Buchnera with 100% of identity |
Eggnog | Catalyzes the attachment of alanine to tRNA(Ala) in a two-step reaction alanine is first activated by ATP to form Ala- AMP and then transferred to the acceptor end of tRNA(Ala). Also edits incorrectly charged Ser-tRNA(Ala) and Gly-tRNA(Ala) via its editing domain (By similarity)(COG0013) |
Kegg | Link to kegg annotations (BU403) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_004505726.1) |
Pfam | tRNA synthetases class II (A) (PF01411.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |