Id Trinity | FTRINITY_DN24552_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_197931 |
Sequence | GAAATGGGGAGTTGGACAAGGAGTCTTGGAACAAAATATCCTAAAATCAAACTGTTCAGATAATTTCGCTGTATCTGCCGTAAACTATAACTATTCAGAT TCCGGTCTCTTCGGGTTCCTGTTAGCATACAACGGCAAAGATGTGAGTAATGTTTTAAAAGCTGCGGTACAGAGCTTAAGATCTCCTACAGTTACCGAAA CCGAAGTGTCCAGGGCCAAGAAGCAATTGATTTTCTCACTTGTATCAGCATCAGAATCTAGTGCTGGAGTCCTAGAAAATATTACATACCAAGCTGCCAC CACTGGAC BLAST |
Tissue | flowers |
Gene name | LI_gene_4163; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_197931
Blastp | Cytochrome b-c1 complex subunit 2, mitochondrial from Bos with 36.9% of identity |
---|---|
Blastx | Cytochrome b-c1 complex subunit 2, mitochondrial from Bos with 36.9% of identity |
Eggnog | peptidase'(COG0612) |
Kegg | Link to kegg annotations (282394) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020238495.1) |
Pfam | Peptidase M16 inactive domain (PF05193.20) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |