Id Trinity | FTRINITY_DN25047_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_221917 |
Sequence | AGATACACTTTACGAAGGAATAAAACAAATTCTAAAATGGATTGAAACCAAACCCTTTCAAAAAATTAATGCCAAATTAGGTGTTGAACCTCTACCAGCC TGTAAAAAACACGAATTTAAATCAAAGGATTACTGGTATTGCACTTTGGGTCAAATAACGTACAACATGTACCATCCTGTTGGTTCCAATCCAATGGGTC CCAATCCTAAGACATCAGTTGTCGACCATGAGTTGAAAGTACATGGAATTAAAAACTTAAGAGTTGCTGATGCCAGCGTCTTTCCATTTACATTATCGGG ACACCCAGTGGCTCCTTGCGTTATGATCGGTGATAAGTTGGCC BLAST |
Tissue | flowers |
Gene name | LI_gene_4434; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_221917
Blastp | Glucose dehydrogenase [FAD, quinone] from Sophophora with 42.11% of identity |
---|---|
Blastx | Glucose dehydrogenase [FAD, quinone] from Sophophora with 42.11% of identity |
Eggnog | oxidoreductase(COG2303) |
Kegg | Link to kegg annotations (Dmel_CG1152) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003612495.2) |
Pfam | GMC oxidoreductase (PF05199.12) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |