Ll_transcript_199751

• Id Trinity: FTRINITY_DN25343_c0_g1_i1
• Name Transcript: Ll_transcript_199751
• Sequence: AGTAGGCCTCTCAGAAGGGTTTCTTTTTGTGCAAAGAAGGGCAAGCTGAAATGCCTTCTTAACATGCCCATCATTAATGCAGGTCACTGACACTTCTGGA TCCACAGCCTCCATTACAGTGTTGTTATCTGCCTTCAACAATATCAATTGATGCAAGTTAGAGTCATTGTCCACTGCTTTCTTCCCAGTTAGTAGCTCTA GCAGAACAATGCCGAAGCTATAGACATCAGACTTTTCGTTCAGTCTTGAAGTTCGGGCATACTCCGGATCAATATAACCTATTGTGCCAAGCACATAAGT TG
• Tissue: flowers
• Gene name: LI_gene_4556;
• Additional information: details;

Expression of Ll_transcript_199751

FPKM

• FPAB: 0.3
• FPNAB: 0
• LF1: 0.2
• LF2: 0.2
• LF3: 0
• LF4: 0
• UF1: 0.2
• UF2: 0
• UF3: 0
• UF4: 0.2

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_199751

• Blastp: LRR receptor-like serine/threonine-protein kinase ERL1 from Arabidopsis with 86% of identity
• Blastx: LRR receptor-like serine/threonine-protein kinase ERL1 from Arabidopsis with 86% of identity
• Eggnog: Serine Threonine protein kinase(COG0515)
• Kegg: Link to kegg annotations (AT5G62230)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_017413181.1)
• Pfam: Protein kinase domain (PF00069.24)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;