| Id Trinity | FTRINITY_DN25574_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_117352 |
| Sequence | AGAAGATTGAAGATAATAACACCTTAGTCTTCATTGTTCACCTTAAAGCAAACAAGCATCACATCAAAGCAGCGGTCAAGAAGCTGTATGATATTGATGT TGCCAAGGTTAACACACTTGTCAGGCCCGACGGAAAGAAGAAGGCATACGTGAGGCTAACAAGAGACTTTGACGCCCTTGATTCCGCCAATAAGATTGGA ATCATCTAAATGTATTTCCTTCTCCTTTATTAAATATCTTCTTAAAACCCACCTTATGGTTTTTTTTAAAACCAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_4664; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_117352
| Blastp | - |
|---|---|
| Blastx | 60S ribosomal protein L23a from Rattus with 84.85% of identity |
| Eggnog | One of the early assembly proteins it binds 23S rRNA. One of the proteins that surrounds the polypeptide exit tunnel on the outside of the ribosome. Forms the main docking site for trigger factor binding to the ribosome (By similarity)(COG0089) |
| Kegg | Link to kegg annotations (360572) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_014494213.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |