| Id Trinity | FTRINITY_DN25629_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_251151 |
| Sequence | CGCGTGTCAAAATGGCGAAAAAGAAATTAGAAGATAAAAACAGCCAAAACGGCGATAATACAAAAAACGAAGACGATTCATCATCGAACGATGAAGAGCC AAACTTCAGCGACCCGGAAGGATTCGTGGACGATATTACGGAAGAAGAATTAATTGGGGACATATTGAAAACAAAACCCAAGGAAACTGACGGCGTAGAG AGTGTTATTGTGGTGGATGGTGTACCTGTAGTTGGCCCCAACCGTATTGAAAAACTTAAGTCTGTAATAAACAAGATTTTTGTTAAAATTGGCAGCATTG TTAATGAGTTTTACCCAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_4686; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_251151
| Blastp | Eukaryotic translation initiation factor 3 subunit B from Rattus with 51.4% of identity |
|---|---|
| Blastx | Eukaryotic translation initiation factor 3 subunit B from Rattus with 51.4% of identity |
| Eggnog | Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome (By similarity)(COG5354) |
| Kegg | Link to kegg annotations (288516) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | - |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |