| Id Trinity | FTRINITY_DN25712_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_216741 |
| Sequence | AATTAACCATGGCAACCACACTAGCCAAGTCCATTTTCACCAAAGTGAACGGCAATTTAATCAAAAATGGACTTCAAAGTCAAATAAAGTTTATGTCTAG TGCAAGCTACGAATACATTAAGGTATCAAAAGCTGGTTCGAAGAGCAATGTAGGAGTCATAACATTAAATCGCCCCAAAGCCCTGAACGCCCTGTGCAAT GGTTTGATGAGTGAAGTAGGCAAAGCCCTAGACACCCTGGAAAGTGACAGCAGTGTGGGGGCTATCATCATCACTGGTAGTGAAAAGGCTTTCGCTGCTG GTGCAGATATAAAAGAAATGCAAAATAACAC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_4710; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_216741
| Blastp | Probable enoyl-CoA hydratase, mitochondrial from Caenorhabditis with 60.64% of identity |
|---|---|
| Blastx | Probable enoyl-CoA hydratase, mitochondrial from Caenorhabditis with 60.64% of identity |
| Eggnog | Enoyl-CoA hydratase(COG1024) |
| Kegg | Link to kegg annotations (CELE_T05G5.6) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_020220519.1) |
| Pfam | Enoyl-CoA hydratase/isomerase (PF00378.19) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |