Id Trinity | FTRINITY_DN25773_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_216708 |
Sequence | AAACGACAACTACGACGATGGCTGAAGGTGAACCAATCCGTGTAGTAGTAACTGGCGCTGCTGGCCAAATTGCATATTCATTGATATCTATGATTGCCAA TGGAGATGTATTTGGAACAAAACAACCAGTCATTTTACACCTCTTAGATATCCCTCCAGCAATGGGAGTTCTTGAAGGAGTTTGCATGGAAATTGATGAT CTTGCATTACCCCTGGTCAAAGGCTACGTAAAAACAACTGAACCAGAAGTAGCATTTAAAGATGTTGATGCTGCTTTCTTGGTGGGTGCAATGCCAAGAA GGGAAGGTATGGAAAGAAAAGACTTGCTGTCAG BLAST |
Tissue | flowers |
Gene name | LI_gene_4737; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_216708
Blastp | Malate dehydrogenase, cytoplasmic from Gallus with 70.3% of identity |
---|---|
Blastx | Malate dehydrogenase, cytoplasmic from Gallus with 70.3% of identity |
Eggnog | Catalyzes the reversible oxidation of malate to oxaloacetate (By similarity)(COG0039) |
Kegg | Link to kegg annotations (421281) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020203287.1) |
Pfam | lactate/malate dehydrogenase, NAD binding domain (PF00056.22) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |