Id Trinity | FTRINITY_DN25779_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_216719 |
Sequence | ATAAAAAGAACATCAAAAAAATTTGTGAGAGTGCTGAAAAGTGGCTTATTCCAATATTAAAAAATAAAGATAGAAAAAAAAAATAACAATATGAAAATTG ATAGTATAAAAGAAAAACTTAATATATTTAAAATACCTCTTAATGGAATAAAATTAATCGAAGCTTCTGCAGGAACAGGAAAAACTTTCACAATAGTCCT ATTAT BLAST |
Tissue | flowers |
Gene name | LI_gene_4743; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_216719
Blastp | - |
---|---|
Blastx | RecBCD enzyme subunit RecB from Buchnera with 96.97% of identity |
Eggnog | The heterodimer acts as both an ATP-dependent DNA helicase and an ATP-dependent, dual-direction single-stranded exonuclease. Recognizes the chi site generating a DNA molecule suitable for the initiation of homologous recombination. The AddA nuclease domain is required for chi fragment generation(COG1074) |
Kegg | Link to kegg annotations (BU454) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019464702.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |