| Id Trinity | FTRINITY_DN25779_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_216719 |
| Sequence | ATAAAAAGAACATCAAAAAAATTTGTGAGAGTGCTGAAAAGTGGCTTATTCCAATATTAAAAAATAAAGATAGAAAAAAAAAATAACAATATGAAAATTG ATAGTATAAAAGAAAAACTTAATATATTTAAAATACCTCTTAATGGAATAAAATTAATCGAAGCTTCTGCAGGAACAGGAAAAACTTTCACAATAGTCCT ATTAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_4743; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_216719
| Blastp | - |
|---|---|
| Blastx | RecBCD enzyme subunit RecB from Buchnera with 96.97% of identity |
| Eggnog | The heterodimer acts as both an ATP-dependent DNA helicase and an ATP-dependent, dual-direction single-stranded exonuclease. Recognizes the chi site generating a DNA molecule suitable for the initiation of homologous recombination. The AddA nuclease domain is required for chi fragment generation(COG1074) |
| Kegg | Link to kegg annotations (BU454) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019464702.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |