| Id Trinity | FTRINITY_DN25914_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_175540 |
| Sequence | GGCGTTTTCAGGATAATTTCGAGTTTTTGCAATGGTTCAAAAAGTTTTTTGACACCAATTACCAAATGAATGATTACGACCCAGTAGGTGCGCGCAGTGG TGAGGGAATGGGAGCAGCCGGTGCAGCAGCCAGAGCAGGTCCTGTCAAAAAGCCATCGGCGGCAGTACCACCTAGAAATGCCACCACCCAAAATCGTTTA TTCCGTCCCGCGAGTAACAGCAATATGTCTAATCGTGTACCCACAACAAGACCAGCAGCACCAGCCAATCAGCGTGATAGAGGCGATCATAAAATTGAAG AACTTACTAGACAGATGAGTGAATTGAGAGTTACAGTTGATGGTTTGGAAAAAGAACGTGATTTCTATTTTGGTAAATTGCGTGATATAGAGATGATATG CCAGGAACAAGAAAGTGAACATCCATTATTCTCTAAAGTATTGGAAATTCTTTATGCTACTGAGG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_4821; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_175540
| Blastp | Microtubule-associated protein RP/EB family member 1 from Silurana with 47.5% of identity |
|---|---|
| Blastx | Microtubule-associated protein RP/EB family member 3 from Rattus with 44.24% of identity |
| Eggnog | microtubule-associated protein RP EB family member(COG5217) |
| Kegg | Link to kegg annotations (394720) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003517319.1) |
| Pfam | EB1-like C-terminal motif (PF03271.16) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |