| Id Trinity | FTRINITY_DN25977_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_175519 |
| Sequence | CCAGAGTCCTCATCACATCGGACGGCGTATGGAGGGGGGAGAAGCTTCTTCAACTAAAAAATATCTGCGACCAATCCATGGCCAGATGCGCACAAAAAGG GCACAACGTGGAGACATGCATTGTCGTGTCCCACCTACAAAGGGTGACGGCACCAAACGGAACTCAAATCAAAACAAACAAGCCCCCAATGCAAGAAGGC AG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_4850; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_175519
| Blastp | - |
|---|---|
| Blastx | Acetyl-coenzyme A synthetase from Sophophora with 49.18% of identity |
| Eggnog | Catalyzes the conversion of acetate into acetyl-CoA (AcCoA), an essential intermediate at the junction of anabolic and catabolic pathways. AcsA undergoes a two-step reaction. In the first half reaction, AcsA combines acetate with ATP to form acetyl-adenylate (AcAMP) intermediate. In the second half reaction, it can then transfer the acetyl group from AcAMP to the sulfhydryl group of CoA, forming the product AcCoA (By similarity)(COG0365) |
| Kegg | Link to kegg annotations (Dmel_CG9390) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_015971838.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |