| Id Trinity | FTRINITY_DN26121_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_19481 |
| Sequence | CAAGCAGCCTGACAATGCTGCTGGAACTCTGGCTGAAGAAGCTAAATACTTTGTTGAATGCCTACTCCTTAACAGAGATGTGGAGGTAGTTTTGGAGTCA ACCAACAACAACAATCTAGTTGGATCCATCCTTCATGAGAAAGGAAATATTGCGGCTGCTTTACTGCGTGAAGGCTTTGCAAGGTGTGTGGATTGGTACA TTGCCCACATGAAGACTGGTGCAGATAAACTTCGTGCTGCTGAGCGTGAGGCTAAAGAAAAGAGACTACGAATTTGGAAGGACTGGACCCCTACGAATGC TAACCCTGGCAAGGAGTATACTGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_4924; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_19481
| Blastp | Staphylococcal nuclease domain-containing protein 1 from Mus with 63.04% of identity |
|---|---|
| Blastx | Staphylococcal nuclease domain-containing protein 1 from Mus with 63.04% of identity |
| Eggnog | nuclease(COG1525) |
| Kegg | Link to kegg annotations (56463) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003602730.1) |
| Pfam | Staphylococcal nuclease homologue (PF00565.16) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |