| Id Trinity | FTRINITY_DN26762_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_160737 |
| Sequence | TAATCACATAACCTATTCCCCCGAGCAATCTCAATTACAATATATACACCAACAAACAATGTTTAACCAGTAACTACTACTAATCAACGCCCATAATCAT ACAAAGCCCCCGCACCAATAGGATCCTCCCGAATCAACCCTGACCCCTCTCCTTCATAAATTATTCAGCTTCCTACACTATTAAAGTTTACCACAACCAC CACCCCATCATACTCTTTCACCCACAGCACCAATCCTACCTCCATCGCT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_5106; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_160737
| Blastp | - |
|---|---|
| Blastx | NADH-ubiquinone oxidoreductase chain 6 from Homo with 94.87% of identity |
| Eggnog | Core subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) that is believed to belong to the minimal assembly required for catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone(ENOG410YP23) |
| Kegg | Link to kegg annotations (4541) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | - |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |