Ll_transcript_151093

• Id Trinity: FTRINITY_DN27267_c0_g1_i1
• Name Transcript: Ll_transcript_151093
• Sequence: CACACTTTCAATAATTGTGTTCCACCCACAGTGAGTCACCAATCCTCCAATGGCCTTATTTTCCAATATGAGAAGCTGAGGTGCCCAACCCCATATCAGA TAACCTTTTTTACTAGCCTTCACTCTCTTCTCAAATTCTTCAAGAAAACTATCTTCTTCACTTTCATCCTTTTTCTTGATCACCCATATGAAATCATGCC CTGATTCTTCAAGGGCTTGAGCTATTTCAACAAGTTGTGAAGAAGGGAACTTGCTCATGCTCCCAAAACTCACATAAAGAACAGAGTTATCTGGCTTGGA ATTAAGCCATTCAAGCCATCCTTGTCCTTTGTCTTCTTCTTCTGCTTTACCATTTCCC
• Tissue: flowers
• Gene name: LI_gene_5233;
• Additional information: details;

Expression of Ll_transcript_151093

FPKM

• FPAB: 0
• FPNAB: 1.5
• LF1: 3.2
• LF2: 0.2
• LF3: 0.7
• LF4: 0.5
• UF1: 5.1
• UF2: 0.9
• UF3: 2.1
• UF4: 1.5

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_151093

• Blastp: Soyasapogenol B glucuronide galactosyltransferase from Soja with 74.79% of identity
• Blastx: Soyasapogenol B glucuronide galactosyltransferase from Soja with 74.79% of identity
• Eggnog: Transferase(COG1819)
• Kegg: Link to kegg annotations (BAI99584)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019423846.1)
• Pfam: UDP-glucoronosyl and UDP-glucosyl transferase (PF00201.17)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;