| Id Trinity | FTRINITY_DN27498_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_82644 |
| Sequence | GAACAAGCTCAGACTGGCTGCTATCCTGGAAAAGGACTATGGTGTCAAGATCAATGTTGCATCAATCTTTGACATTCAGGTGAAACGTATCCATGAGTAC AAGCGCCAGCTCCTGAACTGCCTTCACATCATTACCATGTACAACCGTATTAAGCAGAACCCTCAGGGCAAGTTTGTTCCCAGAACTGTGATGATCGGTG GCAAGGCTGCACCTGGCTACTACATGGCCAAGAGCATTATTCGCCTCATCTGTGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_5279; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_82644
| Blastp | - |
|---|---|
| Blastx | Glycogen phosphorylase from Sophophora with 82.14% of identity |
| Eggnog | Phosphorylase is an important allosteric enzyme in carbohydrate metabolism. Enzymes from different sources differ in their regulatory mechanisms and in their natural substrates. However, all known phosphorylases share catalytic and structural properties (By similarity)(COG0058) |
| Kegg | Link to kegg annotations (Dmel_CG7254) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_020230882.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |