Id Trinity | FTRINITY_DN27507_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_265044 |
Sequence | ATTTTCTCTTCTTTTCTCCAATCACTTTTGTCATATATCCAGAACACAAATCCTAAAAGACACAGAAAGTACATAAAACATAATATTACTAAGAAACTAA AGACAACCTAGTTTCCTATGCCATTACTAACTATTATTTATAAAGGGTTAGGGGTTTCAGGGTGGTTACTAAGCGATTCCAATCAATTGGTCTTAATAGC ATAGAAATGCGAGATATAAATGAATATAAGCATTAAATATGGTGAGGGATTGAGCAAAGACGGAAGAAACAATGATAGCCACGG BLAST |
Tissue | flowers |
Gene name | LI_gene_5280; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_265044
Blastp | - |
---|---|
Blastx | - |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019463661.1) |
Pfam | - |
Rfam | - |
GO | - |