| Id Trinity | FTRINITY_DN27721_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_45970 |
| Sequence | CCTCATGGTCAAGGACTTGTACTCCTCGTACAAGGACCTGCCACTGTGCCTCTATCAGATTCAGAACAAGTATCGCGACGAGGCTCGTCCGCGTGCCGGC ATCCTGCGCGGTCGTGAGTTCGTCATGATGGATGCCTATTCCTTTGATGTCGCTCAGGAAGGGCTCGACGAGGCCTACCAGGCTCAACGCGACGCCTACA TTCGCAT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_5317; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_45970
| Blastp | - |
|---|---|
| Blastx | Proline--tRNA ligase from Cutibacterium with 100% of identity |
| Eggnog | Catalyzes the attachment of proline to tRNA(Pro) in a two-step reaction proline is first activated by ATP to form Pro- AMP and then transferred to the acceptor end of tRNA(Pro). As ProRS can inadvertently accommodate and process non-cognate amino acids such as alanine and cysteine, to avoid such errors it has two additional distinct editing activities against alanine. One activity is designated as 'pretransfer' editing and involves the tRNA(Pro)-independent hydrolysis of activated Ala-AMP. The other activity is designated 'posttransfer' editing and involves deacylation of mischarged Ala-tRNA(Pro). The misacylated Cys- tRNA(Pro) is not edited by ProRS (By similarity)(COG0442) |
| Kegg | Link to kegg annotations (PPA1499) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_013458793.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |