Id Trinity | FTRINITY_DN29223_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_3203 |
Sequence | GTTGAAATCACCGTCAGCTCGGACTCAGCTAAGGTCGATGTGGTAGATCCTGCATTGCGGCAGCTTCCCATTGAGAGGATGATGACACCTCATGTTCTTG TCAACATTGGAGGCAACAAGCAAATCTGCGAATTCTGTGAATACTTTTTGCACTATGTTCAAACGGAAATGGCTGCTGAGAAAACTGTGGAAAAGGCCAA GTCAGTTGTAGAAAAGGCTTGTAGCCGCCTTCCCAAGACCATCGAGGTTCAGTGCAAGGACTTTGTGGATGCTTATGGCAACGCTTTTATTGCTATCTTG GTTCAAGAAATTGATCCGâBLAST |
Tissue | flowers |
Gene name | LI_gene_5652; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_3203
Blastp | Prosaposin from Homo with 34.38% of identity |
---|---|
Blastx | Prosaposin from Homo with 34.38% of identity |
Eggnog | surfactant protein B(ENOG410XSI5) |
Kegg | Link to kegg annotations (5660) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003541325.1) |
Pfam | Saposin-like type B, region 1 (PF05184.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |