Id Trinity | FTRINITY_DN29364_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_175242 |
Sequence | TAAACAGCTAAGCCAAATCGGTGTTACACAATAGTGATTAAATCATCATGGATGAATCAAAGGTTGAAGAAATGGACGAGAAAATTTATGGAGGATGTGA GGGGCCCGATGCCATGTATGTGAAGCTTATATCCTCGGACGGACATGAGTTTATTGTTAAGAGAGAACATGCTCTCACTTCTGGAACCATTAAGGCTATG CTCAGTGGACCTGGTCAATTTGCTGAAAATGAGACAAATGAGGTCAACTTCAGGGAAATTCCGTCACATGTTCTTCAAAAAGTCTGCATGTACTTCACCT ACAAGATACGTTACACAAACAGCTCAACAGAAATTCCTGAATTCAATATTGCACCGGAAATCGCCCTAGAACTGCTGATGGCAGCC BLAST |
Tissue | flowers |
Gene name | LI_gene_5703; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_175242
Blastp | Elongin-C from Rattus with 95.19% of identity |
---|---|
Blastx | Elongin-C from Rattus with 95.19% of identity |
Eggnog | Transcription elongation factor B (SIII), polypeptide 1 (15kDa, elongin C)(ENOG41123WR) |
Kegg | Link to kegg annotations (64525) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_013456162.1) |
Pfam | Skp1 family, tetramerisation domain (PF03931.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |