| Id Trinity | FTRINITY_DN29380_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_175224 |
| Sequence | CAGTGATATAATGAGTATTATCGCTACTACAAGTGGTGTGGCTATTTTCACAGCTGGAACCTGCGTTGGGGCAGTTTCGGCGATATTTCTCAGCAAATTC AGGGCGAAACCGAAAGACCAATCTTGGGAAAACGGACAGGAAGAAAAATTTGAGTTTGAGGACGCGAACGATGAATATAGACTCATTATGGGGGTTAGAA ACGACTTGAAAATGCAAAAAGGAAAAGTCGCTGCTCAATGTGGGCATGCTGCTGTAGCTGCTTATGCGAAAGCATTAAAACAGAAACCAAAAGTTCTTAA AAACTGGCTACGATACGGAAGCACAAAAATAGCTGTTCGATTAGATTCCGAAGAGGAATTAATAAATTTAGACAAAATAGCAAGACAA BLAST |
| Tissue | flowers |
| Gene name | LI_gene_5708; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_175224
| Blastp | Probable peptidyl-tRNA hydrolase 2 from Sophophora with 52.86% of identity |
|---|---|
| Blastx | Probable peptidyl-tRNA hydrolase 2 from Sophophora with 52.86% of identity |
| Eggnog | The natural substrate for this enzyme may be peptidyl- tRNAs which drop off the ribosome during protein synthesis (By similarity)(COG1990) |
| Kegg | Link to kegg annotations (Dmel_CG1307) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (NP_001276301.2) |
| Pfam | Peptidyl-tRNA hydrolase PTH2 (PF01981.15) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |