Ll_transcript_229997

• Id Trinity: FTRINITY_DN30383_c0_g1_i1
• Name Transcript: Ll_transcript_229997
• Sequence: TAGAGCAACTCCACCACCTGGAACAATTCCCTCTTCCACAGCTGCTCGAGTGGCATTTAAAGCATCTGTCACCCTATCTTTCCTTTCCCCAACTTCTGCC TCACTAGCCCCTCCAACCTTGAAAACAGCTACACCACCAGATAGTTTTGATAGCCGCTCCTGTGCTTTTTCTTTATCAAATGTTGCAGCACTCTTATCCA TAGCCAACCTCAGCTGCTCACATCTCTCTTCAATGAGTTTCTTATCCCCGCCACCATGTAGAATGATAGAGTCATCAACGGTAACAGTAACCTTTTTTGC AGTTCCAAG
• Tissue: flowers
• Gene name: LI_gene_6014;
• Additional information: details;

Expression of Ll_transcript_229997

FPKM

• FPAB: 0.2
• FPNAB: 2.4
• LF1: 0.4
• LF2: 0.7
• LF3: 0.8
• LF4: 0.2
• UF1: 1.4
• UF2: 0
• UF3: 0.4
• UF4: 0.4

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_229997

• Blastp: Chaperonin CPN60-like 2, mitochondrial from Arabidopsis with 88.35% of identity
• Blastx: Chaperonin CPN60-like 2, mitochondrial from Arabidopsis with 88.35% of identity
• Eggnog: Prevents misfolding and promotes the refolding and proper assembly of unfolded polypeptides generated under stress conditions (By similarity)(COG0459)
• Kegg: Link to kegg annotations (AT3G13860)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019424599.1)
• Pfam: TCP-1/cpn60 chaperonin family (PF00118.23)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;
  Links to GO: General; Genes and gene products; Annotations; Ontology;