Ll_transcript_232521

• Id Trinity: FTRINITY_DN30444_c0_g1_i1
• Name Transcript: Ll_transcript_232521
• Sequence: CAACGAAGTTCTCCCATCACTTCGACAACCACAAACATGGCTGACGCTGACTACGATCCCGAGGCCGCAGCTGCCCTTAAGGCCAAGAGGGCGTTCCGCA AGTTCTCTTACCGCGGCGTTGACCTCGACCAGCTCCTCGACCTTGGCTCTGAGGAACTCCGCGACCTCGTCCACGCCCGTGCCCGCCGCAGGTTCAACCG TGGTCTCAAGCGCAAGCCCATGGGCCTCATCAAGAAGCTCAGGAAGTCCAAGC
• Tissue: flowers
• Gene name: LI_gene_6029;
• Additional information: -

Expression of Ll_transcript_232521

FPKM

• FPAB: 1.7
• FPNAB: 0
• LF1: 0
• LF2: 0.4
• LF3: 0
• LF4: 0.4
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_232521

• Blastp: -
• Blastx: 40S ribosomal protein S15 from Podospora with 84% of identity
• Eggnog: Protein S19 forms a complex with S13 that binds strongly to the 16S ribosomal RNA (By similarity)(COG0185)
• Kegg: -
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019434979.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;