Ll_transcript_236201

• Id Trinity: FTRINITY_DN30780_c0_g1_i1
• Name Transcript: Ll_transcript_236201
• Sequence: CTCGTATTTTTACTGAAGAAGGAACTTCAATTCCTGTCACTGTAATTGAATTAAAAGAAAATAGAATCACACAAGTAAAAAATATAAATACTGATCTCTA TTGTGCTATTCAAGTAACAACTGGAATAAAAAAATCGAATAGATTAAACAAACCACAATCCGGACATTTTTTAAAATCTGGTGTAACTCCTGGTCGTGGC TTATGGGAATTTAGAACCGATAAAAATAACAATTTTAAAATTGGACAAAGTATTACAATTAACATTTT
• Tissue: flowers
• Gene name: LI_gene_6119;
• Additional information: -

Expression of Ll_transcript_236201

FPKM

• FPAB: 0.7
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 0
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_236201

• Blastp: -
• Blastx: 50S ribosomal protein L3 from Buchnera with 100% of identity
• Eggnog: One of the primary rRNA binding proteins, it binds directly near the 3'-end of the 23S rRNA, where it nucleates assembly of the 50S subunit (By similarity)(COG0087)
• Kegg: Link to kegg annotations (BU524)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_003591792.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;