Id Trinity | FTRINITY_DN30983_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_13142 |
Sequence | CATACGAAAACGACTTCCCTATTCCGTATCCGACTTACTTCCATCCTTCTAATGACAAGGAGATTCTCCAATGGCAAGAAAGGATGAGGAGAATGAAAAG GACTCACTTATTTTCATTTGCAGGTGCACCAAGACCTAATGCAACAAAATCTATCAGAAGTGACCTTATTCAACATTGCCAATCTTCAAAAAGTTGCAAA CTTCTCAATTGTTATGTCAAAAATGAAAACAAATGTGATGATCCTGTGCATGTTATGCAAGTTTTTCAAAGCTCAGTTTTCTGTTTGCAACCACCAGGAG ATTCATATACTAGAAGATCAACTTTTGATTCAATTTTGGGTGGTTGTATTCCTGTGTTCTTTAATCAAAATTCAG BLAST |
Tissue | flowers |
Gene name | LI_gene_6169; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_13142
Blastp | Probable xyloglucan galactosyltransferase GT15 from Arabidopsis with 62.4% of identity |
---|---|
Blastx | Probable xyloglucan galactosyltransferase GT15 from Arabidopsis with 62.4% of identity |
Eggnog | Exostosin(ENOG410XTFH) |
Kegg | Link to kegg annotations (AT2G31990) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019455307.1) |
Pfam | Exostosin family (PF03016.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |