Ll_transcript_247237

• Id Trinity: FTRINITY_DN3103_c0_g1_i1
• Name Transcript: Ll_transcript_247237
• Sequence: CAACGTCGCCAACTTCACAGGACATTCCGGAGCAATCACCACGATTTCCTTCTCGGAAAACGGGTATTACTTGGCCACTGCCGCCGACGACGCGTGCGTA AAACTATGGGATTTGCGTAAATTAAGAAACTTCAAAACTCTACAACTCGACGAAGGTTACCAAATCAAAGATTTGTGTTTCGATCAAAGCGGAACCTATT TGGCCGTTGCCGGAACTGACGTCAGG
• Tissue: flowers
• Gene name: LI_gene_6187;
• Additional information: -

Expression of Ll_transcript_247237

FPKM

• FPAB: 0
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 2.8
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_247237

• Blastp: -
• Blastx: Pre-mRNA-processing factor 19 from Rattus with 77.33% of identity
• Eggnog: PRP19 PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)(ENOG410XPQV)
• Kegg: Link to kegg annotations (246216)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_015949478.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;