| Id Trinity | FTRINITY_DN31925_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_240568 |
| Sequence | GGAAGAGATCTTAGAATACCCTTTGCATTCCAATGGGCTTGTTGAAGTGCCAAAGACTTTAGCTGATATTGTTGAGTCAATTATTGGTGCTGTCTTCATT GATTGTGGCAACTCAGTTGAAACTGTGTGGAGGATTTTTAAAAGTATCCTGGAACCTCTAATTGATCCAAACACTCTTAAAACACATCCAGTGGTAGAGC TTCATGAAGTTTGTCAGAAAAAGAACAAG BLAST |
| Tissue | flowers |
| Gene name | LI_gene_6422; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_240568
| Blastp | - |
|---|---|
| Blastx | Ribonuclease 3-like protein 3 from Oryza sativa with 50% of identity |
| Eggnog | Digests double-stranded RNA. Involved in the processing of primary rRNA transcript to yield the immediate precursors to the large and small rRNAs (23S and 16S). Also processes some mRNAs, and tRNAs when they are encoded in the rRNA operon (By similarity)(COG0571) |
| Kegg | Link to kegg annotations (4340996) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019418601.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |