Id Trinity | FTRINITY_DN32015_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_174623 |
Sequence | GGTGGATTGCCTGAGGTCAGGAGTTCCACACCAGCCTGGCTAACAAGGTGAAACCCCGTCTCTACTAAAAATACAAAACAATTAGCTGGGTGTGGTGGTG CACGCCTGTAGTTTCAGCTATTCGGGGGAAGGGGGTGTTGACGCAGGAGGATCTCTTGAGCCCAGGAGTTTGAGGCTGCAGTGAGCTGTGACTGTACTAC CACACT BLAST |
Tissue | flowers |
Gene name | LI_gene_6453; |
Additional information | - |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_174623
Blastp | - |
---|---|
Blastx | UPF0764 protein C16orf89 from Homo with 58.54% of identity |
Eggnog | chromosome 16 open reading frame 89(ENOG4112ACS) |
Kegg | Link to kegg annotations (146556) |
CantataDB | - |
Mirbase | hsa-mir-5096 (MI0018004) |
Ncbi protein | Link to NCBI protein (XP_019444713.1) |
Pfam | - |
Rfam | Metazoa_SRP (RF00017) |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |