Id Trinity | FTRINITY_DN32153_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_81647 |
Sequence | GGAAAACGGAGCCTGCCTTTGTACGCGCCTTGATGACTGCAATTTGTAAAAGTTCAATGTTTGAGGCTCAACCGAATAACAAATTGACATTAAATGTAGA CAAATTAAGACAAGACAAACTACTCACACGTTATGTTGAGAATAAAGAGGACTTGGAGTTGCAATGTCTGTATGCAGTGCAAGCGCTGGTAACTCAACTA GAGCACCCTCAGGGCCTGATCGTTTCCATATTCACAACACTTTGGGAGGACAACTTAGTATCCACTGAAGCTTTCCAAGCTTGGTTCGACAAGGATGACC CACAAGâBLAST |
Tissue | flowers |
Gene name | LI_gene_6497; |
Additional information | details; |
FPAB | abscising flower pedicels |
FPNAB | non-abscising flower pedicels |
LF1 | lower flowers stage 1 |
LF2 | lower flowers stage 2 |
LF3 | lower flowers stage 3 |
LF4 | lower flowers stage 4 |
UF1 | upper flowers stage 1 |
UF2 | upper flowers stage 2 |
UF3 | upper flowers stage 3 |
UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_81647
Blastp | Eukaryotic translation initiation factor 4 gamma 1 from Homo with 39.56% of identity |
---|---|
Blastx | Eukaryotic translation initiation factor 4 gamma 3 from Homo with 35.35% of identity |
Eggnog | Eukaryotic translation initiation factor 4 gamma(ENOG410XS4P) |
Kegg | Link to kegg annotations (1981) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_015957605.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |