Ll_transcript_40981

• Id Trinity: FTRINITY_DN32359_c0_g1_i1
• Name Transcript: Ll_transcript_40981
• Sequence: CCAGAGGAAAAAAAAATCGTGGCATATCATGAAGCAGGTCATGCCATAGCTGGTTGGTTCCTTAAAAACACTGAACCTTTAGTCAAAGTTTCTATTATTC CTAGAGGTGAAGCCCTCGGTTACGCTCAAGTGCTACCAAGAGAGATGTTCCTTCAAACTAAAGAAGACATTTTTGATAAAATGTGCCAGTTGTTAGGTGG CAGAGTATCAGAAGAAATCTTTTTTAATCGCATCACAACTGGAGCTCAGGATGATCTCAG
• Tissue: flowers
• Gene name: LI_gene_6567;
• Additional information: -

Expression of Ll_transcript_40981

FPKM

• FPAB: 0.4
• FPNAB: 0
• LF1: 0
• LF2: 0
• LF3: 0
• LF4: 0
• UF1: 0
• UF2: 0
• UF3: 0
• UF4: 0

Labels

• FPAB: abscising flower pedicels
• FPNAB   : non-abscising flower pedicels
• LF1: lower flowers stage 1
• LF2: lower flowers stage 2
• LF3: lower flowers stage 3
• LF4: lower flowers stage 4
• UF1: upper flowers stage 1
• UF2: upper flowers stage 2
• UF3: upper flowers stage 3
• UF4: upper flowers stage 4

Annotations of Ll_transcript_40981

• Blastp: -
• Blastx: AFG3-like protein 2 from Bos with 74.42% of identity
• Eggnog: Acts as a processive, ATP-dependent zinc metallopeptidase for both cytoplasmic and membrane proteins. Plays a role in the quality control of integral membrane proteins (By similarity)(COG0465)
• Kegg: Link to kegg annotations (515757)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_004507174.1)
• Pfam: -
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;