| Id Trinity | FTRINITY_DN32812_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_221463 |
| Sequence | CATCGACTTGGGCAGCAAGCAGGTGCACATCAACCCGGAAGACGTAGATCTTTTCGTCTTGCACACTTACGCCAACGTTCTCTACTATCAGAAGGAGCTG GCCAAGTTGGAGACCGTCATCCACGACAAGGTCCAGAGGGCCGTGGACTCGGTGCGCAAAGGCGGCGGCGAAGTTTTGACCGACGCGCAGGTCTGCGAGG CCATCCAGCAGGAGAAGAGGAAGCTGGCGGTGTGCTTCCAGCAGCAGTGCCTCAAGATGAAGAAGGAGATGGAGTGC BLAST |
| Tissue | flowers |
| Gene name | LI_gene_6715; |
| Additional information | - |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_221463
| Blastp | - |
|---|---|
| Blastx | MICOS complex subunit Mic60 from Sophophora with 38.46% of identity |
| Eggnog | Multifunctional regulator of mitochondrial architecture and protein biogenesis. May act in concert with ATP synthase dimers to generate inner membrane structure and consequently normal mitochondrial morphology. Plays a role in keeping cristae membranes connected to the inner boundary membrane. Promotes protein import via the mitochondrial intermembrane space assembly (MIA) pathway (By similarity)(ENOG410Y49V) |
| Kegg | Link to kegg annotations (Dmel_CG6455) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019437155.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |