| Id Trinity | FTRINITY_DN33787_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_86241 |
| Sequence | CTAGAACTTGTGTAGTAAGTGAAGATACACTAGACAATGCTAAGATTTTAGTGGAACAATATAGGAATCGTAGTGAACCTCCAGGCACAAGTTTAGAACA GGTTATTTATGCCAAAAAATTGTACGAGAGTGCATTTCATCCAGACAGTGGAGAAAAACAAAATGTTTTTGGAAGAATGTCCTTTCAAGTGCCTGGGGGC ATGGCTATCACTGGGGCTATGTTACAGTTTTACAGAACGGCCCCGGCTGTTGTTTTCTGGCAATGGGTCAATCAGTCGTTTAACGCACTAGTCAACTACA CAAACAGAAACGCAAAATCGCCAACATCCACCACCCAACGATTAGTAGCATATGTCACTGCAACCTCTTCAGCCATGGGTACAGCCCT BLAST |
| Tissue | flowers |
| Gene name | LI_gene_7025; |
| Additional information | details; |
| FPAB | abscising flower pedicels |
| FPNAB | non-abscising flower pedicels |
| LF1 | lower flowers stage 1 |
| LF2 | lower flowers stage 2 |
| LF3 | lower flowers stage 3 |
| LF4 | lower flowers stage 4 |
| UF1 | upper flowers stage 1 |
| UF2 | upper flowers stage 2 |
| UF3 | upper flowers stage 3 |
| UF4 | upper flowers stage 4 |
Annotations of Ll_transcript_86241
| Blastp | Sideroflexin-2 from Bos with 72.03% of identity |
|---|---|
| Blastx | Sideroflexin-2 from Bos with 72.03% of identity |
| Eggnog | SideroFleXiN(ENOG410YU8V) |
| Kegg | Link to kegg annotations (513450) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_016173715.1) |
| Pfam | Tricarboxylate carrier (PF03820.16) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |