Ll_transcript_175585

Id TrinityFTRINITY_DN34154_c0_g1_i1
Name TranscriptLl_transcript_175585
SequenceTGAAAAGTCTTTCGGCCCAGCGGAGAATAGATTTGTGGAGGGCAAGGTGTCAAGGTCCTATTTTCCAAGAAATCGCAAACATGGCAGCTGCACTACGATC CGCTGTTGCGACTGCCCGTCCAGTTGTGGAGAAGAACTTGAAGATTGCTTTGCACTATGCCAAGGCTGAATTGACACCTCCCAAGCCCACCGAACTTGGC CAGGTTGCCAAGGGATTCAACAACATCTTGACATCATTCCGCACTGGTCGTTACAAGCAGTTGACTGTCAAGGAGGCTTGGCTCAATGTGCTCGTTGCCA CTGAGGTCGCCTGCTGGTTCTTCATTGGCGAATGTATTGGCAGGAGACACCTCGTTGGATACTACGTTCCCCCAACTCACCCTCATTAATCTAGTTACTT ATTGCTTATTTGGATTGTAGATTTTATGATTGTACAGTACATGCATTAAGAAAAACTTTTGGTCCCATTTTGCCATGAATTTATCTTGC BLAST
Tissueflowers
Gene nameLI_gene_7155; 
Additional informationdetails; 

Expression of Ll_transcript_175585

Labels

FPAB abscising flower pedicels
FPNAB    non-abscising flower pedicels
LF1 lower flowers stage 1
LF2 lower flowers stage 2
LF3 lower flowers stage 3
LF4 lower flowers stage 4
UF1 upper flowers stage 1
UF2 upper flowers stage 2
UF3 upper flowers stage 3
UF4 upper flowers stage 4

Annotations of Ll_transcript_175585

BlastpATP synthase subunit g, mitochondrial from Mus with 49.49% of identity
BlastxATP synthase subunit g, mitochondrial from Pongo with 55.56% of identity
EggnogMitochondrial membrane ATP synthase (F(1)F(0) ATP synthase or Complex V) produces ATP from ADP in the presence of a proton gradient across the membrane which is generated by electron transport complexes of the respiratory chain. F-type ATPases consist of two structural domains, F(1) - containing the extramembraneous catalytic core, and F(0) - containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. Part of the complex F(0) domain. Minor subunit located with subunit a in the membrane(ENOG4111TZ1)
KeggLink to kegg annotations (27425)
CantataDB-
Mirbase-
Ncbi proteinLink to NCBI protein (XP_003529513.1)
PfamMitochondrial ATP synthase g subunit (PF04718.14)
Rfam-
GOLinks to GO: General; Genes and gene products; Annotations; Ontology;
Links to GO: General; Genes and gene products; Annotations; Ontology;